Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1610656
End position: 1610679
Length: 24

DNA sequence
>NC_013929, from 1610656 to 1610679 (24 bp); Streptomyces scabiei 87.22 GACCACGACCGCGGCCACGCCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1609682-1611805	Sequence	SCAB_14401 - hypothetical protein (Protein is coded in complementary strand; from 1611805 to 1609682)