Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1617022
End position: 1617057
Length: 36

DNA sequence
>NC_013929, from 1617022 to 1617057 (36 bp); Streptomyces scabiei 87.22 AAGGCATCCCTTCAGGCATTCCTTCAGGCATTCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1616649-1618433	Sequence	SCAB_14451 - hypothetical protein (Protein is coded in complementary strand; from 1618433 to 1616649)