Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1661604
End position: 1661633
Length: 30

DNA sequence
>NC_013929, from 1661604 to 1661633 (30 bp); Streptomyces scabiei 87.22 GGCGACGCCGACGGCGAGGGCGAAGGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1661428-1663197	Sequence	SCAB_14901 - membrane transporter (Protein is coded in complementary strand; from 1663197 to 1661428)