Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1746683
End position: 1746718
Length: 36

DNA sequence
>NC_013929, from 1746683 to 1746718 (36 bp); Streptomyces scabiei 87.22 CGGGCGAGGCCGCGGACGAGGGCGCGGACGAGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1745941-1746825	Sequence	SCAB_15681 - cysteine ABC transporter (Protein is coded in complementary strand; from 1746825 to 1745941)