Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1758778
End position: 1758801
Length: 24

DNA sequence
>NC_013929, from 1758778 to 1758801 (24 bp); Streptomyces scabiei 87.22 CGGCGGCACGGCGGCGCGGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1758033-1759946	Sequence	SCAB_15771 - amino acid dioxygenase (Protein is coded in complementary strand; from 1759946 to 1758033)