Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2008864
End position: 2008899
Length: 36

DNA sequence
>NC_013929, from 2008864 to 2008899 (36 bp); Streptomyces scabiei 87.22 GTCTCCGTCTCGGTGACCGTCTCGGTCTCGGTCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2008336-2009241	Sequence	SCAB_17821 - hypothetical protein (Protein is coded in complementary strand; from 2009241 to 2008336)