Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2016447
End position: 2016470
Length: 24

DNA sequence
>NC_013929, from 2016447 to 2016470 (24 bp); Streptomyces scabiei 87.22 GGGTCCGGGGGTCGGGGGGTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2015717-2016514	Sequence	SCAB_17891 - hypothetical protein (Protein is coded in complementary strand; from 2016514 to 2015717)