Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2204080
End position: 2204103
Length: 24

DNA sequence
>NC_013929, from 2204080 to 2204103 (24 bp); Streptomyces scabiei 87.22 CGGTGGTGGTGGCCGTGGCGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2203737-2205719	Sequence	SCAB_19481 - calcium-binding protein (Protein is coded in complementary strand; from 2205719 to 2203737)