Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2228865
End position: 2228889
Length: 25

DNA sequence
>NC_013929, from 2228865 to 2228889 (25 bp); Streptomyces scabiei 87.22 CGCCGCGACGGGCCGCCCCGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2228623-2229309	Sequence	SCAB_19661 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 2229309 to 2228623)