Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2344983
End position: 2345006
Length: 24

DNA sequence
>NC_013929, from 2344983 to 2345006 (24 bp); Streptomyces scabiei 87.22 CAGCGGCAGCGGCAGCGGCAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2344733-2345674	Sequence	SCAB_20721 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 2345674 to 2344733)