Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 251783
End position: 251806
Length: 24

DNA sequence
>NC_013929, from 251783 to 251806 (24 bp); Streptomyces scabiei 87.22 GCGGCGGTGGCGGAGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 251474-252373	Sequence	SCAB_2311 - DNA-binding protein (Protein is coded in complementary strand; from 252373 to 251474)