Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2762904
End position: 2762957
Length: 54

DNA sequence
>NC_013929, from 2762904 to 2762957 (54 bp); Streptomyces scabiei 87.22 GCCGCCGTCTTCTTGGCGGCTACGGTCTTCTTGGCGGGGGCCGCCTTCTTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2761824-2763374	Sequence	SCAB_24441 hrdB major vegetative sigma factor HrdB (Protein is coded in complementary strand; from 2763374 to 2761824)