Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 277257
End position: 277286
Length: 30

DNA sequence
>NC_013929, from 277257 to 277286 (30 bp); Streptomyces scabiei 87.22 GTCGCCGTAGCCGTCGCCGTCGACATCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 276655-278352	Sequence	SCAB_2591 - hypothetical protein (Protein is coded in complementary strand; from 278352 to 276655)