Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2790746
End position: 2790781
Length: 36

DNA sequence
>NC_013929, from 2790746 to 2790781 (36 bp); Streptomyces scabiei 87.22 TGTCTTCCGCCTTGTCTTCCGCCTTGTCTTCCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2790709-2792745	Sequence	SCAB_24661 - ATP-binding protein (Protein is coded in complementary strand; from 2792745 to 2790709)