Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2822651
End position: 2822695
Length: 45

DNA sequence
>NC_013929, from 2822651 to 2822695 (45 bp); Streptomyces scabiei 87.22 CGTACGACCGATCGTCGTCCGGCCTATCGTCGTACGGTCGGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2821894-2822871	Sequence	SCAB_24941 - RecX family transcriptional regulator (Protein is coded in complementary strand; from 2822871 to 2821894)