Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2880911
End position: 2880940
Length: 30

DNA sequence
>NC_013929, from 2880911 to 2880940 (30 bp); Streptomyces scabiei 87.22 GCCGACGCCGTCGCCGAGGCCGATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2878196-2881942	Sequence	SCAB_25311 - large Pro/Ala/Gly-rich protein (Protein is coded in complementary strand; from 2881942 to 2878196)