Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2883124
End position: 2883147
Length: 24

DNA sequence
>NC_013929, from 2883124 to 2883147 (24 bp); Streptomyces scabiei 87.22 CGTCGTCCTCGTCGGCGTCGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2883114-2883569	Sequence	SCAB_25331 rbfA ribosome-binding factor A (Protein is coded in complementary strand; from 2883569 to 2883114)