Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2886277
End position: 2886321
Length: 45

DNA sequence
>NC_013929, from 2886277 to 2886321 (45 bp); Streptomyces scabiei 87.22 GCCGCCACCACCGGGACCGCGGCCACCGGGGCCACCGCCGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2884133-2887249	Sequence	SCAB_25351 - translation initiation/elongation factor (Protein is coded in complementary strand; from 2887249 to 2884133)