Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2891702
End position: 2891725
Length: 24

DNA sequence
>NC_013929, from 2891702 to 2891725 (24 bp); Streptomyces scabiei 87.22 CGGTCAGGCGGTCAGGCGGTCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2891714-2893417	Sequence	SCAB_25421 proS prolyl tRNA synthetase (Protein is coded in complementary strand; from 2893417 to 2891714)