Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2966368
End position: 2966421
Length: 54

DNA sequence
>NC_013929, from 2966368 to 2966421 (54 bp); Streptomyces scabiei 87.22 CGTCCGCGGCCGGAGCCTCGGCGGCGGCCGGGGCCTCCTCGGCGGCGGGAGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2966355-2967281	Sequence	SCAB_26021 rpsB 30S ribosomal protein S2 (Protein is coded in complementary strand; from 2967281 to 2966355)