Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2984874
End position: 2984900
Length: 27

DNA sequence
>NC_013929, from 2984874 to 2984900 (27 bp); Streptomyces scabiei 87.22 CCCGGCATGCCCGGCATCCCGGGCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2984664-2986214	Sequence	SCAB_26231 ffh signal recognition particle protein (Protein is coded in complementary strand; from 2986214 to 2984664)