Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3026511
End position: 3026570
Length: 60

DNA sequence
>NC_013929, from 3026511 to 3026570 (60 bp); Streptomyces scabiei 87.22 GCCGTCGACTTCTTGGCCGGGGCCTTCTTGGCCGTGGCCTTCTTCGCCGGCGCCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3026469-3027122	Sequence	SCAB_26581 - histone-like DNA binding protein (Protein is coded in complementary strand; from 3027122 to 3026469)