Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3064294
End position: 3064320
Length: 27

DNA sequence
>NC_013929, from 3064294 to 3064320 (27 bp); Streptomyces scabiei 87.22 CGGCGCTCACGCCGCTCACGCCGCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3064134-3064640	Sequence	SCAB_26921 - hypothetical protein (Protein is coded in complementary strand; from 3064640 to 3064134)