Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 306643
End position: 306669
Length: 27

DNA sequence
>NC_013929, from 306643 to 306669 (27 bp); Streptomyces scabiei 87.22 CGGTCTCGGCGGTCTCGGCGGTCTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 305937-306710	Sequence	SCAB_2861 - hypothetical protein (Protein is coded in complementary strand; from 306710 to 305937)