Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3132667
End position: 3132702
Length: 36

DNA sequence
>NC_013929, from 3132667 to 3132702 (36 bp); Streptomyces scabiei 87.22 CCGGGTGGAGAGCCGGGTGGAGAGCCGGGTGGAGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3132618-3133085	Sequence	SCAB_27511 - hypothetical protein (Protein is coded in complementary strand; from 3133085 to 3132618)