Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3135804
End position: 3135830
Length: 27

DNA sequence
>NC_013929, from 3135804 to 3135830 (27 bp); Streptomyces scabiei 87.22 GCGGTCGGCGCGGACGGCGAGGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3133906-3136992	Sequence	SCAB_27531 - transcriptional regulator (Protein is coded in complementary strand; from 3136992 to 3133906)