Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3170681
End position: 3170704
Length: 24

DNA sequence
>NC_013929, from 3170681 to 3170704 (24 bp); Streptomyces scabiei 87.22 GCTGCGGATGCGGATGCGGATGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3170050-3170724	Sequence	SCAB_27841 - two-component system response regulator (Protein is coded in complementary strand; from 3170724 to 3170050)