Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3230276
End position: 3230311
Length: 36

DNA sequence
>NC_013929, from 3230276 to 3230311 (36 bp); Streptomyces scabiei 87.22 TCCTCGTCCTTCGGCTCGTCCTTCGGCTCGTCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3229256-3230638	Sequence	SCAB_28251 - membrane-bound hydrophilic protein (Protein is coded in complementary strand; from 3230638 to 3229256)