Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3290265
End position: 3290288
Length: 24

DNA sequence
>NC_013929, from 3290265 to 3290288 (24 bp); Streptomyces scabiei 87.22 CTCCGCCTCCTCCTGCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3290056-3291132	Sequence	SCAB_28891 prfA peptide chain release factor 1 (RF-1) (Protein is coded in complementary strand; from 3291132 to 3290056)