Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3296247
End position: 3296291
Length: 45

DNA sequence
>NC_013929, from 3296247 to 3296291 (45 bp); Streptomyces scabiei 87.22 GCTGGCCGCCGCCCTGCTGACCGCCGCCCTGCTGCTCGTCGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3294908-3297049	Sequence	SCAB_28931 rho hypothetical protein (Protein is coded in complementary strand; from 3297049 to 3294908)