Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 333985
End position: 334029
Length: 45

DNA sequence
>NC_013929, from 333985 to 334029 (45 bp); Streptomyces scabiei 87.22 GCCGGCCTCCCGGTCACCGGCCTTCCGGTCGCCGGTTCCCCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 332360-335020	Sequence	SCAB_3061 - phosphoenolpyruvate-utilizing protein (Protein is coded in complementary strand; from 335020 to 332360)