Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3359097
End position: 3359150
Length: 54

DNA sequence
>NC_013929, from 3359097 to 3359150 (54 bp); Streptomyces scabiei 87.22 CGCCGCCGTCGTCCTGGCCGCGGCCGTCGTCCTGGACGCCGTCGTCTTCTTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3358975-3360099	Sequence	SCAB_29491 - DNA-binding protein (Protein is coded in complementary strand; from 3360099 to 3358975)