Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3360225
End position: 3360264
Length: 40

DNA sequence
>NC_013929, from 3360225 to 3360264 (40 bp); Streptomyces scabiei 87.22 CGTCTCACGGCGTCTTGCGGCGTCTTGCGGCGTCGCACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3360230-3360523	Sequence	SCAB_29501 - hypothetical protein (Protein is coded in complementary strand; from 3360523 to 3360230)