Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3364483
End position: 3364506
Length: 24

DNA sequence
>NC_013929, from 3364483 to 3364506 (24 bp); Streptomyces scabiei 87.22 GGCGCGGGGGCCCGGGGGCGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3363996-3364799	Sequence	SCAB_29531 - hypothetical protein (Protein is coded in complementary strand; from 3364799 to 3363996)