Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3371792
End position: 3371845
Length: 54

DNA sequence
>NC_013929, from 3371792 to 3371845 (54 bp); Streptomyces scabiei 87.22 GCCGTCAGCTGATCCGCTGCCGTCAGCTGATCCGCTGCCGTCAGCTGATCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3371388-3371804	Sequence	SCAB_29601 - hypothetical protein
ORF... 3371833-3372459	Sequence	SCAB_29611 - hypothetical protein (Protein is coded in complementary strand; from 3372459 to 3371833)