Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3379943
End position: 3379966
Length: 24

DNA sequence
>NC_013929, from 3379943 to 3379966 (24 bp); Streptomyces scabiei 87.22 CAGGCCCAGTCCGAGGCCCTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3379074-3381953	Sequence	SCAB_29701 - hypothetical protein (Protein is coded in complementary strand; from 3381953 to 3379074)