Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3421257
End position: 3421280
Length: 24

DNA sequence
>NC_013929, from 3421257 to 3421280 (24 bp); Streptomyces scabiei 87.22 TGGGCCTGGGCGTTGGCCTCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3420936-3422531	Sequence	SCAB_30071 - Na+/H+ antiporter (Protein is coded in complementary strand; from 3422531 to 3420936)