Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3506665
End position: 3506688
Length: 24

DNA sequence
>NC_013929, from 3506665 to 3506688 (24 bp); Streptomyces scabiei 87.22 CGCAGTCGCAGTCGCAGTCGCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3506423-3508483	Sequence	SCAB_30891 - glycosyl transferase family protein (Protein is coded in complementary strand; from 3508483 to 3506423)