Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3531271
End position: 3531297
Length: 27

DNA sequence
>NC_013929, from 3531271 to 3531297 (27 bp); Streptomyces scabiei 87.22 GACGAGGAGGACGAGGACGACGCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3531199-3531648	Sequence	SCAB_31121 - hypothetical protein (Protein is coded in complementary strand; from 3531648 to 3531199)