Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3558551
End position: 3558586
Length: 36

DNA sequence
>NC_013929, from 3558551 to 3558586 (36 bp); Streptomyces scabiei 87.22 CTCCGTCGGTTCCTCCGCCGGTTCCTCCGGCGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3558516-3559631	Sequence	SCAB_31391 - peptide ABC transporter (Protein is coded in complementary strand; from 3559631 to 3558516)