Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3815839
End position: 3815862
Length: 24

DNA sequence
>NC_013929, from 3815839 to 3815862 (24 bp); Streptomyces scabiei 87.22 GTGGCGGTGGTGGTGTCGGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3815749-3816264	Sequence	SCAB_33811 - hypothetical protein (Protein is coded in complementary strand; from 3816264 to 3815749)