Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3847708
End position: 3847761
Length: 54

DNA sequence
>NC_013929, from 3847708 to 3847761 (54 bp); Streptomyces scabiei 87.22 CTGCCCGGGTAGGAGTCACGGCCCGGGTGGGAGTCCCTGTCCGGGAAGAAGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3847237-3847773	Sequence	SCAB_34091 - hypothetical protein (Protein is coded in complementary strand; from 3847773 to 3847237)
ORF... 3847760-3848749	Sequence	SCAB_34101 - serine/threonine protein kinase (Protein is coded in complementary strand; from 3848749 to 3847760)