Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3900841
End position: 3900885
Length: 45

DNA sequence
>NC_013929, from 3900841 to 3900885 (45 bp); Streptomyces scabiei 87.22 CGGCGGCCGCGGCCTCGGCGGCCTCGGCCTCGGAGGCGGGGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3900717-3901880	Sequence	SCAB_34551 cya adenylate cyclase (Protein is coded in complementary strand; from 3901880 to 3900717)