Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3906441
End position: 3906467
Length: 27

DNA sequence
>NC_013929, from 3906441 to 3906467 (27 bp); Streptomyces scabiei 87.22 GCCCCACCGGCCCCACCGGCCCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3906387-3906881	Sequence	SCAB_34611 - hypothetical protein (Protein is coded in complementary strand; from 3906881 to 3906387)