Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3950939
End position: 3950974
Length: 36

DNA sequence
>NC_013929, from 3950939 to 3950974 (36 bp); Streptomyces scabiei 87.22 CGTCCGCCGGCTCGTCCGCCGGCTCGTCCGTCGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3950113-3951444	Sequence	SCAB_35031 - N-acylneuraminate cytidylyltransferase (Protein is coded in complementary strand; from 3951444 to 3950113)