Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3973350
End position: 3973379
Length: 30

DNA sequence
>NC_013929, from 3973350 to 3973379 (30 bp); Streptomyces scabiei 87.22 CGGCACCGGCACCGGCACCGGCACCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3972965-3973594	Sequence	SCAB_35221 - hypothetical protein (Protein is coded in complementary strand; from 3973594 to 3972965)