Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 3995249
End position: 3995272
Length: 24

DNA sequence
>NC_013929, from 3995249 to 3995272 (24 bp); Streptomyces scabiei 87.22 CGTGTACGTGTACTTGTACGGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3992523-3999794	Sequence	SCAB_35431 - hypothetical protein (Protein is coded in complementary strand; from 3999794 to 3992523)