Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4035887
End position: 4035940
Length: 54

DNA sequence
>NC_013929, from 4035887 to 4035940 (54 bp); Streptomyces scabiei 87.22 CGGTCGGGAGGCGGGGTGCGGTCGGGAGGCGGGGTGCGGTCGGGAGGCGGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4035872-4037878	Sequence	SCAB_35771 - hypothetical protein (Protein is coded in complementary strand; from 4037878 to 4035872)