Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4045691
End position: 4045714
Length: 24

DNA sequence
>NC_013929, from 4045691 to 4045714 (24 bp); Streptomyces scabiei 87.22 AGCTCCACCTCCCGCTCCAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4044518-4046923	Sequence	SCAB_35831 - hypothetical protein (Protein is coded in complementary strand; from 4046923 to 4044518)