Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4085789
End position: 4085815
Length: 27

DNA sequence
>NC_013929, from 4085789 to 4085815 (27 bp); Streptomyces scabiei 87.22 CACCGGGCGCACCGAGCGCACCGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4084990-4086771	Sequence	SCAB_36151 pkaD protein serine/threonine kinase (Protein is coded in complementary strand; from 4086771 to 4084990)